Misplaced Pages

Haplogroup R2

Article snapshot taken from Wikipedia with creative commons attribution-sharealike license. Give it a read and then ask your questions in the chat. We can research this topic together.
(Redirected from Haplogroup R-M479) Human Y-chromosome DNA haplogroup
Haplogroup R2
Possible time of origin27,000 BP
Possible place of originSouth Asia or Central Asia
AncestorHaplogroup R
DescendantsR2a (M124);
R2b (FGC21706)
Defining mutationsM479

Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).

R-M479 has been concentrated geographically in South Asia and Central Asia since prehistory. It appears to reach its highest levels among the Burusho people in North Pakistan.

It has two primary branches: R2a (M124) and R2b (R-FGC21706)

Structure

  • R (M207/Page37/UTY2)
    • R1 (M173/P241/Page29)
    • R2 (M479/PF6107, L266/PF6108, L722, L726)
      • R2a (M124, F820/Page4, L381, P249)
        • R2a1 (L263)
        • R2a2 (P267/PF6109)
      • R2b (FGC21706, FGC50198, FGC50325, FGC50333, SK2163, SK2164, SK2165, SK2166)
        • R2b1 (FGC50339)


Source: ISOGG 2017.

Geographical distribution

Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).

In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)

In 2013, R2(xR2a) was found in 5 out of 19 males from the Burusho minority of North Pakistan.

R2a (R-M124)

Haplogroup R2a (R-M124) is characterized by SNPs M124, F820/Page4, L381, P249, and is mainly found in South Asia, with lower frequencies in Central Asia. R-M124 is also found in multiple Jewish populations: Iraqi Jews, Persian Jews, Mountain Jews, and Ashkenazi Jews.

R2b (R-FGC21706)

It is found especially in the Indian subcontinent.

Phylogenetic tree

M479

R2*

M124

 R2a

 FGC21706

 R2b

Description of the SNP M479

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
RefSNP ID -
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg

See also

Y-DNA R-M207 subclades

Y-DNA backbone tree

Phylogenetic tree of human Y-chromosome DNA haplogroups
This article needs to be updated. Please help update this article to reflect recent events or newly available information. (February 2021)
"Y-chromosomal Adam"
A00 A0-T 
A0 A1 
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1  F-Y27277   F3  GHIJK
G HIJK
IJK H
IJ K
I   J     LT        K2 
I1   I2  J1   J2  L     T  K2e K2d K2c K2b   K2a
K2b1    P  K-M2313 
S   M     P1   NO1
P1c P1b P1a N O
R Q
Footnotes
  1. Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809. S2CID 23291764.
  2. International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).
  4. Haplogroup A1 is also known as A1'2'3'4.
  5. F-Y27277, sometimes known as F2'4, is both the parent clade of F2 and F4 and a child of F-M89.
  6. Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  7. Between 2002 and 2008, Haplogroup T-M184 was known as "Haplogroup K2". That name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
  8. Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  9. Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.
  10. Haplogroup P (P295) is also klnown as K2b2.
  11. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik op. cit.; YFull YTree v5.08, 2017, "K-M2335", and; PhyloTree, 2017, "Details of the Y-SNP markers included in the minimal Y tree" (Access date of these pages: 9 December 2017)
  12. Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)
  13. Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

Notes

  1. ^ ISOGG, 2017, Y-DNA Haplogroup R and its Subclades – 2017 (17 June 2017).
  2. ^ Cristofaro, Julie Di; Pennarun, Erwan; Mazières, Stéphane; Myres, Natalie M.; Lin, Alice A.; Temori, Shah Aga; Metspalu, Mait; Metspalu, Ene; Witzel, Michael; King, Roy J.; Underhill, Peter A.; Villems, Richard; Chiaroni, Jacques (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  3. Kevin Alan Brook, The Jews of Khazaria, Third Edition, Rowman & Littlefield, 2018, p. 185.
  4. "R-FGC50227 YTree". YFull. Retrieved 15 February 2024.

External links

Categories: