Misplaced Pages

LRRC24
Identifiers
Aliases	LRRC24, LRRC14OS, leucine rich repeat containing 24
External IDs	MGI: 3605040; HomoloGene: 86785; GeneCards: LRRC24; OMA:LRRC24 - orthologs
Gene location (Human) Chr. Chromosome 8 (human) Band 8q24.3 Start 144,522,388 bp End 144,527,033 bp
Gene location (Mouse) Chr. Chromosome 15 (mouse) Band 15|15 D3 Start 76,599,476 bp End 76,606,373 bp
RNA expression pattern Bgee Human Mouse (ortholog) Top expressed in gonad Pituitary Gland anterior pituitary Hypothalamus Brodmann area 9 anterior cingulate cortex superior frontal gyrus prefrontal cortex nucleus accumbens right hemisphere of cerebellum Top expressed in superior frontal gyrus lumbar subsegment of spinal cord primary visual cortex neural layer of retina dentate gyrus of hippocampal formation granule cell central gray substance of midbrain cerebellar cortex supraoptic nucleus dorsal tegmental nucleus hippocampus proper More reference expression data BioGPS n/a
Orthologs Species Human Mouse Entrez 441381 378937 Ensembl ENSG00000254402 ENSMUSG00000033707 UniProt Q50LG9 Q8BHA1 RefSeq (mRNA) NM_001024678 NM_198119 RefSeq (protein) NP_001019849 NP_932787 Location (UCSC) Chr 8: 144.52 – 144.53 Mb Chr 15: 76.6 – 76.61 Mb PubMed search
Wikidata
View/Edit Human View/Edit Mouse

Leucine rich repeat containing 24 is a protein that, in humans, is encoded by the LRRC24 gene. The protein is represented by the official symbol LRRC24, and is alternatively known as LRRC14OS. The function of LRRC24 is currently unknown. It is a member of the leucine-rich repeat (LRR) superfamily of proteins.

Gene

In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand. LRRC24 is composed of five exons, and only a single gene isoform has been identified.

Protein

General features

LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide. The mature form of the protein has a molecular weight of 52.9 kDa. The isoelectric point of the mature human protein is 7.98 The protein is largely composed of alpha helices.

Domains

LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain.

Localization

LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.

Homology

LRRC24 is conserved in Euteleostomi with the exception of Aves. Also, based on sequence homology analysis, distant orthologs of LRRC24 are also conserved in invertebrates of phyla Mollusca and Arthropoda. No human paralogs of LRRC24 have been identified.

Expression

Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain. Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation.

Interactions

Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24. ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates.

LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs). IGFBP7 is also involved in the stimulation of cell adhesion.

Clinical significance

To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance.

References

1. ^ GRCh38: Ensembl release 89: ENSG00000254402 – Ensembl, May 2017
2. ^ GRCm38: Ensembl release 89: ENSMUSG00000033707 – Ensembl, May 2017
3. "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
4. "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
5. ^ "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-02-29.
6. ^ "GeneCard". www.genecards.org. Retrieved 2016-05-09.
7. "LRRC24 Gene (Protein Coding)". genecards.com. Retrieved February 22, 2016.
8. Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S (March 1992). "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America. 89 (6): 2002–6. Bibcode:1992PNAS...89.2002B. doi:10.1073/pnas.89.6.2002. PMC 48584. PMID 1549558.
9. ^ Kozlowski LP (October 2016). "IPC - Isoelectric Point Calculator". Biology Direct. 11 (1): 55. doi:10.1186/s13062-016-0159-9. PMC 5075173. PMID 27769290.
10. Borrelli KW, Vitalis A, Alcantara R, Guallar V (November 2005). "PELE: Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation. 1 (6): 1304–11. doi:10.1021/ct0501811. PMID 26631674.
11. "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-02-29.
12. Petersen TN, Brunak S, von Heijne G, Nielsen H (September 2011). "SignalP 4.0: discriminating signal peptides from transmembrane regions". Nature Methods. 8 (10): 785–6. doi:10.1038/nmeth.1701. PMID 21959131. S2CID 16509924.
13. ^ "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-05-09.
14. ^ "NCBI Conserved Domain Search". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
15. Krogh A, Larsson B, von Heijne G, Sonnhammer EL (January 2001). "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology. 305 (3): 567–80. doi:10.1006/jmbi.2000.4315. PMID 11152613.
16. ^ "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
17. SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator".
18. "HomoloGene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
19. Thompson JD, Higgins DG, Gibson TJ (November 1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research. 22 (22): 4673–80. doi:10.1093/nar/22.22.4673. PMC 308517. PMID 7984417.
20. ^ "GDS868 / GATCCATTGCTGAGCTTGCG". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
21. "GDS3142 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
22. ^ "GDS3917 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
23. "Experiment Detail :: Allen Brain Atlas: Mouse Brain". mouse.brain-map.org. Retrieved 2016-05-09.
24. Gilsohn E, Volk T (2010-01-01). "Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells". Cell Adhesion & Migration. 4 (3): 368–71. doi:10.4161/cam.4.3.11606. PMC 2958611. PMID 20404543.
25. ^ Söllner C, Wright GJ (2009-01-01). "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology. 10 (9): R99. doi:10.1186/gb-2009-10-9-r99. PMC 2768988. PMID 19765300.
26. "Home - dbVar - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.

• Genes on human chromosome 8
• Membrane proteins